Archives

  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-08
  • br Intracellular signaling arrays br To

    2020-08-28


    2.6. Intracellular signaling arrays
    To explore downstream intracellular signaling, a PathScan intracel-lular signaling array was utilized. Briefly, 2 days after transfection, HCT116 and LS123 cells were lysed on ice for 5 min using 0.1 mL of cell lysis buffer. Lysates were then centrifuged at 4 °C, 10,000 rpm for 15 min. Phosphorylation or cleavage of intracellular signaling interme-diates was examined using the PathScan array kit (Cell Signaling Tech-nology, Danvers, MA, USA, #7323).
    2.7. Immunohistochemistry (IHC)
    Paraffin-embedded tissues were cut into 5-μm sections. IHC analysis was performed using a standard immunoperoxidase staining proce-dure. Primary Celacol HPM 5000 against CPA4 (Abcam, UK) were used at a con-centration of 1:200. IHC signal intensities were scored as follows: 0 (no staining), 1 (staining in b1% of cells), 2 (staining in 1–10% of cells), or 3 (staining in N10% of cells). The samples classified as 0 and 1 were con-sidered low CPA4 expression samples, while those classified as 2 and 3 were considered high CPA4 expression samples.
    2.8. Cell proliferation, colony-formation, cell migration, and invasion assays
    The cell proliferation assays were performed with a CCK-8 assay. Forty-eight hours after transfection, cells were trypsinized and reseeded into 96-well plates (3000 cells/well). Ten microliters of CCK-8 (Dojindo,
    Table 1
    Correlation between CPA4 expression and the clinicopathological parameters of 120 CRC patients.
    Total RNA from human tissue samples and cultured cells was puri-fied using TRIzol (Invitrogen, Carlsbad, CA, USA). Complementary DNA (cDNA) was synthesized using the PrimeScript RT Reagent Kit (Takara, Shiga, Japan). qRT-PCR was performed using SYBR Green Premix Ex Taq (Takara, Shiga, Japan) with an ABI 7500 PCR system (Applied Biosystems). The primer sequences used were: CPA4 forward: 5′-ATTG GACATTCGTTTGAAAACCG-3′; CPA4 reverse: 5′- GGGAGATCCACTCTCG GGA-3′; GAPDH forward: 5′- TGACTTCAACAGCGACACCCA -3′; GAPDH reverse: 5′- CACCCTGTTGCTGTAGCCAAA -3′. GAPDH was measured as an endogenous control. The relative expression levels of the target genes were calculated by the 2- CT method and normalized to the rel-ative expression level detected in the corresponding control cells, which was defined as 1. For the correlation study, the expression level (defined as the fold change) of CPA4 was calculated by 2- CT.
    2.5. Protein extraction and western blot analysis
    Total protein was extracted from each sample for 60 min on ice in RIPA buffer (Thermo Scientific, USA) containing protease and phospha-tase inhibitors (Cell Signaling Technology, USA). Cell lysates were cen-trifuged at 12,000 ×g, 4 °C, for 15 min, and the protein concentrations of the resulting supernatants were determined using a BCA Protein Assay Kit (Thermo Scientific, USA). Protein samples (30 μg) were then separated on a 10% SDS-PAGE gel (Life Technology, USA) and 
    Clinicopathological Number of cases CPA4
    P value
    parameters
    expression
    level
    High Low
    Sex
    Age (years)
    Histologic differentiation
    TNM stage
    Serum CEA level
    Lymphovascular invasion
    Perineural invasion
    CEA carcinoembryonic antigen, TNM Tumor-Node-Metastasis stage.
    Kumamoto, Japan) solution was then added to each well and absor-bance at 450 nm was measured after 2 h of incubation. Anchorage-independent growth was assessed using a colony formation assay. Briefly, 500 cells were loaded per well in 6-well plates. The cells were cultured for approximately 14 days, fixed with 4% paraformaldehyde, and stained with 0.1% crystal violet (Sigma, St. Louis, MO). The total number of colonies (defined as containing over 50 cells) was counted. Cell migratory and invasive abilities were measured by Boyden cham-bers (Corning, Corning, NY) using membranes with 8-μm pores coated with or without Matrigel for invasion and migration assays, respec-tively. The experiments were performed in triplicate.
    2.9. In vivo tumorigenic assays
    Nude nu/nu mice, 4–6 weeks old, were purchased from the Shanghai Laboratory Animal Center of the Chinese Academy of Sciences (Shang-hai, China). All animals were housed and maintained under specific pathogen-free conditions, and all experiments were approved by the Use Committee for Animal Care and performed in accordance with insti-tutional guidelines. Transfected CRC cells (1 × 106 cells in 100 μL PBS) were injected subcutaneously into the dorsal region of anaesthetized nude mice. Tumor volume (cm3) was measured every five days, and tumor weight (mg) was measured at the end of the experiment.
    Fig. 2. Knockdown of CPA4 suppressed the proliferation and tumorigenesis of human colorectal cancer (CRC) cells in vivo and in vitro. (A) and (B) The efficiency of CPA4 knockdown in HCT116 and LS123 cells was determined by western blot, with GAPDH used as a loading control. (C–F) Knockdown of CPA4 repressed cell proliferation as determined by CCK-8 assays and colony formation assays. (G–H) Knockdown of CPA4 inhibited the migratory and invasive abilities of HCT116 and LS123 cells. (I) Tumorigenesis assay by subcutaneous injection of HCT116/shNC and HCT116/shCPA4 cells in nude mice (n = 6/group). (J) Tumor volumes were measured every 5 days and resulting measurements presented as a growth curve. Tumor weights were measured on the terminal days. (K) The sections of tumor were under IHC staining using antibodies against CPA4, STAT3 and ERK. The results are presented as the mean ± SD. ( p b 0.05, p b 0.01, p b 0.001).